View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_low_20 (Length: 269)
Name: NF14155_low_20
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 45 - 252
Target Start/End: Original strand, 4981718 - 4981925
Alignment:
| Q |
45 |
attcctatgtttaaaaatattcgttttcactatttttatacattacaactactttctatcttgatttggatttctgttaccttaaatatctctctcaatg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4981718 |
attcctatgtttaaaaatattcgttttcactatttttatacattacaactactttctatcttgatttggatttctgttaccttaaatatctctctcaatg |
4981817 |
T |
 |
| Q |
145 |
tattaaccataagagtttatcattcttcaccaagaggagtgcccctttggtctcaaccctttcaaaggtcattgtggtccctccagtttcccaagctttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4981818 |
tattaaccataagagtttatcattcttcaccaagaggagtgcccctttggtctcaaccctttcaaaggtcattgtggtccctccagtttcccaagctttc |
4981917 |
T |
 |
| Q |
245 |
atgttttc |
252 |
Q |
| |
|
|||||||| |
|
|
| T |
4981918 |
atgttttc |
4981925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 48
Target Start/End: Original strand, 4981668 - 4981702
Alignment:
| Q |
14 |
cataggtgcagttaaaaatttgatcacacaaattc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4981668 |
cataggtgcagttaaaaatttgatcacacaaattc |
4981702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 68 - 140
Target Start/End: Original strand, 4985159 - 4985231
Alignment:
| Q |
68 |
ttttcactatttttatacattacaactactttctatcttgatttggatttctgttaccttaaatatctctctc |
140 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| ||||| ||| | | || |||||||||||||| |||||| |
|
|
| T |
4985159 |
ttttcactatttttatacattacatctattttgggtcttgttttagttatcagttaccttaaatatatctctc |
4985231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University