View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_low_22 (Length: 253)
Name: NF14155_low_22
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 48286420 - 48286251
Alignment:
| Q |
16 |
ataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286420 |
ataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctct |
48286321 |
T |
|
| Q |
116 |
ataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286320 |
ataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
48286251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University