View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_low_24 (Length: 240)
Name: NF14155_low_24
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 38 - 231
Target Start/End: Complemental strand, 15107869 - 15107677
Alignment:
| Q |
38 |
atattttgagttaattgctaatcattagaaattaattaattgttgtagttaatataatcaaaattattggaagannnnnnnaaattatatgtaggcttag |
137 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||| |||| ||||||||||||| ||||| |
|
|
| T |
15107869 |
atattttgagttaattgctgatcattagaaattaattaattgttgtagctattataatcaaaattattgaaagatttttt-aaattatatgtagtcttag |
15107771 |
T |
 |
| Q |
138 |
tgtttattgttataatatgttggatcataatgaaatttctcaaaagtgcaagagaatttgactaacttcaaattatgaagtgaactagtataat |
231 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||| ||||||| |||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15107770 |
tgtttattattataatatgttggattataatgaaatttctcgaaagtgcgagagaattggactaacttcagattatgaagtgaactagtataat |
15107677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University