View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14156_high_4 (Length: 395)
Name: NF14156_high_4
Description: NF14156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14156_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 27 - 381
Target Start/End: Complemental strand, 8851230 - 8850876
Alignment:
| Q |
27 |
ttagttattattaagttagtttagttatgctgttttgtatcctttgtactaccttggtagcggcgaaggaggagaagtagtgagaatcatcgactttaac |
126 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||||||||||||| |||||||| ||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8851230 |
ttagttattattaagttaatttagttatgttgtattgtatcctttgtaataccttgggagcggagaaggagaagaagtagtgagaatcatcgactttaac |
8851131 |
T |
|
| Q |
127 |
agcggtttcgtcttttgcaagaggccattggatttcatcggcgatccgagcatagacggcgatggaattttcaccttgacggagacggacgacggtgaag |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8851130 |
agcggtttcgtctttagcaagaggccattggatttcatcggcgatccgagcatagacggcgatggaattttcaccttggcggagacggacgacggtgaag |
8851031 |
T |
|
| Q |
227 |
tcaccggaagcaagttcaacgctgtattgttgatcgatgaggttgagaatggctccggggattttgataagaatctgttcggtagtttccggcggtgcag |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851030 |
tcaccggaagcaagttcaacgctgtattgttgatcgatgaggttgagaatggctccggggattttgataagaatctgttcggtagtttccggcggtgcag |
8850931 |
T |
|
| Q |
327 |
aaggcgaagtggtattgacgccggcggtggtggtggtgtcagggaagggattttc |
381 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8850930 |
aaggcgaagtggtgttgacgccggcggtggtggtggtgtcagggaagagattttc |
8850876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 31870823 - 31870882
Alignment:
| Q |
235 |
agcaagttcaacgctgtattgttgatcgatgaggttgagaatggctccggggattttgat |
294 |
Q |
| |
|
||||||||| | ||||||||||||||| || |||| |||||||| |||||||||||||| |
|
|
| T |
31870823 |
agcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgat |
31870882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University