View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14156_low_12 (Length: 210)
Name: NF14156_low_12
Description: NF14156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14156_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 45102108 - 45101936
Alignment:
| Q |
19 |
taggtctgaccgtagtattcaaaatggagtagatgttaagcaaacatgttgaactataatctcttatatataatgtcatgaatcagagtacgaatctcta |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45102108 |
taggtctgactgtagtattcaaaatggagtagatgttaaacaaacatgttgaactataatctcttatatacaatgtcatgaatcagagtacgaatctcta |
45102009 |
T |
 |
| Q |
119 |
ttgagagagatgtctatatatcatatttgatagtgtctcgaataaaattatctctaataaaaggaatgaaatc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45102008 |
ttgagagagatgtctatatatcatatttgatagtgtcttgaataaaattatctctaataaaaggaatgaaatc |
45101936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University