View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14156_low_9 (Length: 332)
Name: NF14156_low_9
Description: NF14156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14156_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 12828007 - 12827700
Alignment:
| Q |
19 |
tcctggtctcaagataaatgtagttggaagttccttcggtaatcgaggtcgtgctggttttggtggtcttattcgcaatgatgttggaggatggatccat |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12828007 |
tcctggtctcaagataaatgtagatggaagttccttcggtaatccaggtcgtgctggttttggtggtcttattcgcaatgatgttggaggatggatccat |
12827908 |
T |
 |
| Q |
119 |
gggttctctaaatcttgtggtcgtgtttctaaccttcttgctgagctctatgccatcctcaatgggcttccgttggcttgggatttaggatttagaatca |
218 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12827907 |
ggtttctctgaatcttgtggtcgtgtttctaaccttcttgttgagctctatgccatcctcaatgggcttcagttggcttgggatttaggatttagaatca |
12827808 |
T |
 |
| Q |
219 |
ttactttggaatctgattataaatcggctcttgatcttattctcgataacgacacgacttatcatcctcatgccattgttctgggtcggattcgtacctt |
318 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12827807 |
ttactttggaacctgattataaatcagctcttgatcttattctcgataacgacacgacttatcatcctcatgccattgttctgggtcggattcgtaccct |
12827708 |
T |
 |
| Q |
319 |
catatcac |
326 |
Q |
| |
|
||| |||| |
|
|
| T |
12827707 |
catgtcac |
12827700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University