View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14157_high_6 (Length: 341)
Name: NF14157_high_6
Description: NF14157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14157_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 301 - 341
Target Start/End: Original strand, 13206390 - 13206430
Alignment:
| Q |
301 |
taaaagatcacactagttgttttattttttcggggtcaagt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13206390 |
taaaagatcacactagttgttttattttttcggggtcaagt |
13206430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University