View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14158_high_6 (Length: 286)

Name: NF14158_high_6
Description: NF14158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14158_high_6
NF14158_high_6
[»] chr4 (1 HSPs)
chr4 (199-273)||(6002057-6002131)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 199 - 273
Target Start/End: Complemental strand, 6002131 - 6002057
Alignment:
199 atattaagtgtatatacccttgatggaaaaatttaaacatcaatgaaaattttctgagaacattttgagatagaa 273  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6002131 atattaagtgtatatacccttgatggaaaaatttaaacatcaatgaaaattttctgagaacattttgagatagaa 6002057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University