View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14158_high_9 (Length: 219)
Name: NF14158_high_9
Description: NF14158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14158_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 40 - 184
Target Start/End: Complemental strand, 43094219 - 43094077
Alignment:
| Q |
40 |
cttcaacagaaacaattgttacagcaaggattgggtgtcagattatgtggggccctatacggattgtttgtagtaactcctaattttaacgttaatgaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094219 |
cttcaacagaaacaattgttacagcaaggattgggtgtcagattatgtggggccctatacggattgtttgtagtaactcctaattttaacgttaatgaaa |
43094120 |
T |
 |
| Q |
140 |
acnnnnnnnnnncatctaacaatataacaacctcctttcgttgtc |
184 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43094119 |
ac--aaaaaaaccatctaacaatataacaacctcctttcgttgtc |
43094077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University