View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14158_low_12 (Length: 256)
Name: NF14158_low_12
Description: NF14158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14158_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 44446273 - 44446035
Alignment:
| Q |
1 |
ccatagccgccagatgtttcgttattagagtaattatcagtgttcttattgtaaccagtttcatagtcaccaccagaattgtcattaccatatgatgnnn |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44446273 |
ccatagccgccagatgtttcattattagagtaattatcggtgttcttattgtaaccagtttcatagtcaccaccagaattgtcattaccatatgatgttt |
44446174 |
T |
|
| Q |
101 |
nnnngttatagtcatcatcacctgtagagtatgatgatgttttgttgtaaccactgtcagtgtctattggcctattatcatcatcatcatgcttcttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44446173 |
ttttgttatagtcatcatcacctgtagagtatgatgatgttttgttgtaaccactgtcagtgtctattggcctattatcatcatcatcatgcttcttgtg |
44446074 |
T |
|
| Q |
201 |
gtggaagaggccacggctacggttctcttcttcagacat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44446073 |
gtggaagaggccacggctacggttctcttcttcagacat |
44446035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University