View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14159_low_11 (Length: 224)
Name: NF14159_low_11
Description: NF14159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14159_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 55671957 - 55671758
Alignment:
| Q |
1 |
gccacccattgcattattagtgaccatgatgagctatctgtaggacgattctgtaatagcaacgtgcattccttgatgctcattattttt-ccaaccaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55671957 |
gccacccattgcattattagtgaccatgatgagctatctgtaggacgattctgtaatagcaacgtgcattccttgatgctcattattttttccaaccaaa |
55671858 |
T |
 |
| Q |
100 |
acaatggacctgatgatatactcgagctacattcacgttgaccaataattttattggatgatttaataactaacaatccttccaaaaagaattattgaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55671857 |
acaatggacctgatgatatactcgagctacattcacgttgaccaataattttattggatgatttaataactaacaatccttccaaaaagaattattgaac |
55671758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University