View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14160_high_12 (Length: 241)
Name: NF14160_high_12
Description: NF14160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14160_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 2400281 - 2400493
Alignment:
| Q |
15 |
caaaggtgaattaactaaagcaaagtatcaataatgatagttatagatataaaatgtgtaccttatgagttcttggaagaatgcactcttcttggatcca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2400281 |
caaaggtgaattaactaaagcaaagtatcaataatgatagttaaagatataaaatgtgtaccttatgagttcttggaagaatgcactcttcttggatcca |
2400380 |
T |
 |
| Q |
115 |
caaaattcaagttggcatatcaaagtagatgttgacaaataaagatcaaatcaattgcatatagttgttctttggcttcttggcacattaagatttaggg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2400381 |
caaaattcaagttggcatatcaaagtagatgttgacaaataaagatcaaatcaattgcatatagttgttctttggcttcttggcacattaagatttaggg |
2400480 |
T |
 |
| Q |
215 |
tcatcacaatttt |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2400481 |
tcatcacaatttt |
2400493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University