View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14160_high_19 (Length: 225)
Name: NF14160_high_19
Description: NF14160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14160_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 14169020 - 14168807
Alignment:
| Q |
1 |
gaattcttggttctagtcttgagaatagtataatccctacatttgaatcggtaagaatgttccttccttctaatgagaaagttattgaacgtataattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14169020 |
gaattcttggttctagtcttgagaatagtataatccctacatttgaatcggtaagaatgttccttccttctaatgagaaagttattgaacgtatacttca |
14168921 |
T |
 |
| Q |
101 |
ttgtaaacatttctttggtcattttcattttattagaaatgttaagatgttacttgatgatggagtcattcactcaaatatcacttttttattgcttaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14168920 |
ttgtaaacatttctttggtcattttcattttattagaaatgttaagatgttacttgatgatggagtcattcactcaaatatcacttttttattgcttaga |
14168821 |
T |
 |
| Q |
201 |
agaccgtctatatt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14168820 |
agaccgtctatatt |
14168807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University