View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14160_high_7 (Length: 340)
Name: NF14160_high_7
Description: NF14160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14160_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 14169057 - 14169381
Alignment:
| Q |
1 |
ttgaagcaccttttgaggttaaaaattcaaactttggcaaaacccttttgtaggggtcacatttaagaatgttgggtgcttgtctaatgatgttttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14169057 |
ttgaagcaccttttgaggttaaaaattcaaactttggcaaaacccttttgtaggggtcacatttaagaatgtcgggtgcttgtctaatgatgttttttat |
14169156 |
T |
|
| Q |
101 |
ctgagaatcagagaaaccgtagtttctgaaaacagcgataactgaatcgggtttttgggaagtgtcgaattgaactagttttgaagcttttgaagcggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14169157 |
ctgagaatcagagaaaccgtagtttctgaaaacagcgataactgaatcgggttttcgggaagtgtcgaattgaactagttttgaagcttttgaagcggtt |
14169256 |
T |
|
| Q |
201 |
tctgatgagaaaccgaaattggtaatgagatatgaaactgtgaattgggtttgttgtgaagtggttgaggagttgtggttcaaagacagggttgaaagag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
14169257 |
tctgatgagaaaccgaaattggtaatgagatatgaaactgtgaattgggtttgttgtgaagtggttgaggagttgtggttcaatgagagggttgaaagag |
14169356 |
T |
|
| Q |
301 |
aagaaatggattttggggttgaaat |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14169357 |
aagaaatggattttggggttgaaat |
14169381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University