View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14160_low_12 (Length: 250)
Name: NF14160_low_12
Description: NF14160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14160_low_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 9475718 - 9475479
Alignment:
| Q |
10 |
aataatattaattataattgtttatgcatttact--atgtcactaaatttttgttattcaatgcataattgcattgaggttaaattaggaacacttaaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9475718 |
aataatattaattataattgtttatgcatttacaccatgtccctaattttttgttattcaatgcataattgcattgaggttaaattaggaacacttaaca |
9475619 |
T |
 |
| Q |
108 |
aaattgatcttaaacgatgccccacttctcctttgtgaatactatttaactttttcattagatattcccttttgtgcacaaaaagttacnnnnnnnnnnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9475618 |
aaattgatcttaaacgatgccccacttctcctttgtgaatactatttaactttttcattagatattcccttttgtgcacaaaaagttac---aaaaaaaa |
9475522 |
T |
 |
| Q |
208 |
ttaaaacatccttcttaaggggtcattaaaatgttgtgtccaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9475521 |
ttaaaacatccttcttaaggggtcattaaaatgttgtgtccaa |
9475479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University