View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14160_low_6 (Length: 365)
Name: NF14160_low_6
Description: NF14160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14160_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 17 - 358
Target Start/End: Complemental strand, 37064748 - 37064407
Alignment:
| Q |
17 |
atcaagttgtcatttgaccgatatctttgcatccgttaagcatgtgagttttactaattcacttgcaactcttgatctctcagcaaaccatttcgattct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37064748 |
atcaagttgtcatttgaccgatatctttgcatccgttaagcatgtgagttttactaattcacttgcaactcttgatctctcagcaaaccatttcgattct |
37064649 |
T |
 |
| Q |
117 |
gaattacctgcttggttgtttgaacatggcaacgatatgaatatctcccatattgaccttagcttcaattttttaaaaggacaaataccaaagagcttgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37064648 |
gaattacctgcttggttgtttgaacacggcaacgatatgaatatctcccatattgaccttagcttcaattttttaaaaggacaaataccaaagagcttgt |
37064549 |
T |
 |
| Q |
217 |
taagtcttcgaaaacttgaaactttaaggttgagtaacaatgaactaaatgaatctattcctgattggttagggcaacatgaaaatttaaaataccttgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37064548 |
taagtcttcgaaaacttgaaactttaaggttgagtaacaatgaactaaatgaatctattcctgattggttagggcaacatgaaaatttaaaataccttgg |
37064449 |
T |
 |
| Q |
317 |
tctagctgagaacatgtttcgcggttctatcccttcatctct |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37064448 |
tctagctgagaacatgtttcgcggttctatcccttcatctct |
37064407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University