View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14161_low_6 (Length: 250)
Name: NF14161_low_6
Description: NF14161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14161_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 30 - 241
Target Start/End: Original strand, 6029593 - 6029789
Alignment:
| Q |
30 |
tatatatcataatccacatacttttttacgggtagggttctttactatctattgcgggaagagttcaagttcctaaaagtgtgatctatagtatgtttat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6029593 |
tatatatcataatccacatacttttttacgggtagggttctttactatctattgcgggaagagttcaagttcctaaaagtgtgatctatagt-------- |
6029684 |
T |
 |
| Q |
130 |
ctttagttttcttatttattcatggcctaattaatctcttatcaacaccattggcagatggattatataaactttacgtgatctggtgactgtgatcaaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6029685 |
-------tttcttatttattcatggcctaattaatctcttatcaacaccattggcagatggattatataaactttacgtgatctggtgactgtgatcaaa |
6029777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 38616030 - 38615974
Alignment:
| Q |
84 |
cgggaagagttcaagttccta-aaagtgtgatctatagtatgtttatctttagtttt |
139 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
38616030 |
cgggaagagttcaagtttttataaagtgtgatttatagtatgttcatctatagtttt |
38615974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University