View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14161_low_7 (Length: 207)
Name: NF14161_low_7
Description: NF14161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14161_low_7 |
 |  |
|
| [»] scaffold1995 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 38546679 - 38546507
Alignment:
| Q |
18 |
aatgttgccatagcacttcctaaactatgtcccgttaacgtaatactaacttcttcgttaggaaattttgctaacaaccttctcacttcccctaaaactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38546679 |
aatgttgccatagcacttcctaaactatgtcccgttaacgtaatactaacttcttcgttaggaaatttcgctaacaaccttctcacttcccctaaaactt |
38546580 |
T |
 |
| Q |
118 |
gttctcttgcggaatatttacaataaccgtcttttatgtgtctatcggtgtacatatcaagaaaacctgcttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38546579 |
gttctcttgcggaatatttacaataaccgtcttttatgtgtctatcggtgtacatatcgagaaaacctgcttc |
38546507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 38553129 - 38552957
Alignment:
| Q |
18 |
aatgttgccatagcacttcctaaactatgtcccgttaacgtaatactaacttcttcgttaggaaattttgctaacaaccttctcacttcccctaaaactt |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38553129 |
aatgttgccatagcactacctaaactatgtcccgttaacgtaatactaacttcttcgttaggaaatttcgctaacaaccttctcacttcccctaaaactt |
38553030 |
T |
 |
| Q |
118 |
gttctcttgcggaatatttacaataaccgtcttttatgtgtctatcggtgtacatatcaagaaaacctgcttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38553029 |
gttctcttgcggaatatttacaataaccgtcttttatgtgtctatcggtgtacatatcgagaaaacctgcttc |
38552957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1995 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: scaffold1995
Description:
Target: scaffold1995; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 792 - 620
Alignment:
| Q |
18 |
aatgttgccatagcacttcctaaactatgtcccgttaacgtaatactaacttcttcgttaggaaattttgctaacaaccttctcacttcccctaaaactt |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
792 |
aatgttgccatagcactccctaaactatgtccggttaacgtaatacttacttcttcgttaggaaatttcgctaacaaccttctcacttcccctaaaacct |
693 |
T |
 |
| Q |
118 |
gttctcttgcggaatatttacaataaccgtcttttatgtgtctatcggtgtacatatcaagaaaacctgcttc |
190 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
692 |
gttctcttgaggaatatttacaataaccgtcttttgtttgtctatcggtgtacatatcaagaaaacctgcttc |
620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University