View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14162_low_15 (Length: 368)
Name: NF14162_low_15
Description: NF14162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14162_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 6360819 - 6361059
Alignment:
| Q |
1 |
gctgctgttgttggaggaagttaatgtccacgtgattatgaggggaaacaaatgaagggagtaagccactggatcaaaattgctgcaaaaacctatgcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360819 |
gctgctgttgttggaggaagttaatgtcctcgtgattatgaggggaaacaaatgaagggagtaagccactggatcaaaattgctgcaaaaacctatgcgg |
6360918 |
T |
 |
| Q |
101 |
ctgagaccatataacaggaacaatatttcaggtttgagcgaattgtattgctaaacatacggttacatatattctgccttccaatactataatcatggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360919 |
ctgagaccatataacaggaacaatatttcaggtttgaacgaattgtattgctaaacataaggttacatatattctgccttccaatactataatcatggag |
6361018 |
T |
 |
| Q |
201 |
atatcttacctactctagctgcaagtgagttggccgtgagt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361019 |
atatcttacctactctagctgcaagtgagttggccgtgagt |
6361059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 242 - 352
Target Start/End: Original strand, 6361085 - 6361194
Alignment:
| Q |
242 |
atctgcttgcaagtgtgctaacattaatattgtgagctagctgcagtgtgctatgatatcattgaagtgtgcaggtgctaacttaagtgtgaatatctgt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
6361085 |
atctgcttgcaagtgtgctaacattaatattgtgagctagctgcagtgtgctatgatatcattgaagtgtgcaggtgctaac-taagtgtaaatatctgt |
6361183 |
T |
 |
| Q |
342 |
acattaattac |
352 |
Q |
| |
|
||||||||||| |
|
|
| T |
6361184 |
acattaattac |
6361194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University