View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14162_low_17 (Length: 315)
Name: NF14162_low_17
Description: NF14162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14162_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 26896182 - 26895884
Alignment:
| Q |
1 |
tgatatcatataagctcaaatcaccaatattatagttacgagtatgaataaattgacgtataaaattagtcatttctgccttcttgttttccatcattgc |
100 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26896182 |
tgatatcatttaagctcagatcaccaatattatagttacgagtatgaataaattgacgtataaaattagtcatttccgccttcttgttttccatcattgc |
26896083 |
T |
|
| Q |
101 |
tttctcataattctctttggctttttcaatcctttgcatccaaaagctatatagatccaccatatttttgtttcttttgagttcagaaaaactctcaaac |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
26896082 |
tttctcatacttctctttggctttttcaatcctttgcatccaaaagctatatagatccaccatatttttgtttcttttgagttcagacaaattctcaaac |
26895983 |
T |
|
| Q |
201 |
ttgtgcaacacacgttctagtcctatcgcggatggccaaacttctgcttgaccatggttttcaccatagattattgcacatacctctaccccacaaagg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26895982 |
ttgtgcaacacacgttctagtcctatcgcggatggccaaacttctgcttgaccatggttttcaccatagattattgcacatacctctaccccacaaagg |
26895884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University