View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14162_low_18 (Length: 314)
Name: NF14162_low_18
Description: NF14162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14162_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 24 - 298
Target Start/End: Complemental strand, 26896158 - 26895884
Alignment:
| Q |
24 |
caatattatagttacgagtatgaataaattgacgtataaaattagtcatttctgccttcttgttttccatcattgctttctcataattctctttggcttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26896158 |
caatattatagttacgagtatgaataaattgacgtataaaattagtcatttccgccttcttgttttccatcattgctttctcatacttctctttggcttt |
26896059 |
T |
|
| Q |
124 |
ttcaatcctttgcatccaaaagctatatagatccaccatatttttgtttcttttgagttcagaaaaactctcaaacttgtgcaacacacgttctagtcct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26896058 |
ttcaatcctttgcatccaaaagctatatagatccaccatatttttgtttcttttgagttcagacaaattctcaaacttgtgcaacacacgttctagtcct |
26895959 |
T |
|
| Q |
224 |
atcgcggatggccaaacttctgcttgaccatggttttcaccatagattattgcacatacctctaccccacaaagg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26895958 |
atcgcggatggccaaacttctgcttgaccatggttttcaccatagattattgcacatacctctaccccacaaagg |
26895884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University