View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14162_low_2 (Length: 1467)

Name: NF14162_low_2
Description: NF14162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14162_low_2
NF14162_low_2
[»] chr3 (1 HSPs)
chr3 (1406-1449)||(49768277-49768320)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 1406 - 1449
Target Start/End: Complemental strand, 49768320 - 49768277
Alignment:
1406 tgttcactttgtgattcattcagtatacctctagtcatgcgtag 1449  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
49768320 tgttcactttgtgattcattcagtatacctctagtcatgcgtag 49768277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University