View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14162_low_21 (Length: 298)
Name: NF14162_low_21
Description: NF14162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14162_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 202
Target Start/End: Complemental strand, 12879190 - 12879002
Alignment:
| Q |
14 |
atataccaaaagaagagtaacccacaaatgaaaaacaataggtggcaatggcaccatgtcgcatagtgagaggtcacattcgtcacatattatatttata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12879190 |
atataccaaaagaagagtaacccacaaatgaaaaacaatgggtggcaatggcaccatgtcgcatagtgagaggtcacattcgtcacatattatatttata |
12879091 |
T |
 |
| Q |
114 |
gtggcttaaagaagccaatcatttcgttgctttctttatcacataaatcacaaaataatagggttatagggacctgcacgtgattcatg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12879090 |
gtggcttaaagaagccaatcatttcgttgctttctttatcacataaatcacaaaataatagggttatagggacctgcacgtgattcatg |
12879002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 281
Target Start/End: Complemental strand, 12878964 - 12878923
Alignment:
| Q |
240 |
gctacctcctctaaattctaatggatccaccatccatatttt |
281 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
12878964 |
gctaccccctctaaattctaatccatccaccatccatatttt |
12878923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University