View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14163_low_13 (Length: 352)
Name: NF14163_low_13
Description: NF14163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14163_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 160 - 301
Target Start/End: Complemental strand, 35747687 - 35747546
Alignment:
| Q |
160 |
tggaattaagtaattataaaccttaaaagtaaaaactgtttttgttgtgtgtgtatgtaactacttccaacgtgtttgtttctgttcttcaacttcttct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35747687 |
tggaattaagtaattataaaccttaaaagtaaaaactgtttttgttgtgtgtgtatgtaactacttccaacgtgtttgtttctgttcttcaacttcttct |
35747588 |
T |
 |
| Q |
260 |
tctacacannnnnnnnctgaatcttgaatcttcggttactaa |
301 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
35747587 |
tctacacattttttttctgaatcttgaatcttcggttactaa |
35747546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 35747839 - 35747749
Alignment:
| Q |
8 |
tcatcttttctcctacctgtttgtgaaaataccgaagagaaagaaagaaaatatttaagtttatgaaatgataatgatgatgattatggtt |
98 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35747839 |
tcatcttttcttctacctgtttgtgaaaataccgaatagaaagaaagaaaatatttaagtttatgaaatgataatgatgatgattatggtt |
35747749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University