View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14163_low_23 (Length: 232)
Name: NF14163_low_23
Description: NF14163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14163_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 36631610 - 36631442
Alignment:
| Q |
18 |
agaagttaatcgcaaggagaaattgatggtgtgtgattatagctgtttgtgttgatgggtgattgaagcgtggtgtttgatgtttaacgtgccacatann |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36631610 |
agaagttaatcgcaaggagaaattgatggtgtgtgattatagctgtttgtgttgatgggtgattgaagcgtggtgtttgatgtttaacgtgccacatatt |
36631511 |
T |
 |
| Q |
118 |
nnnnnaattaaataggggtgagtgttaacaacttggttaacctgtaaccaggtaaatcacctttaaaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36631510 |
tttttaattaaataggggtgagtgttaacaacttggttaacctgtaaccaggtaaatcacctttaaaaa |
36631442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 212
Target Start/End: Complemental strand, 36631036 - 36631001
Alignment:
| Q |
177 |
cctttaaaaatggttgacgtggcctaacaatactgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36631036 |
cctttaaaaatggttgacgtggcctaacaatactgg |
36631001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 9399521 - 9399582
Alignment:
| Q |
147 |
aacttggttaacctgtaaccaggtaaatcacctttaaaaatggttgacgtggcctaacaata |
208 |
Q |
| |
|
|||||||||| ||| ||||||||||||| || ||| ||||||||||||||||| |||||||| |
|
|
| T |
9399521 |
aacttggttagcctataaccaggtaaataactttttaaaatggttgacgtggcttaacaata |
9399582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University