View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14163_low_9 (Length: 475)
Name: NF14163_low_9
Description: NF14163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14163_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 44 - 325
Target Start/End: Original strand, 24181029 - 24181310
Alignment:
| Q |
44 |
agcaacaaccaccatcatcctccatggttgtttcttacaaagaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtga |
143 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24181029 |
agcaacaaccaccatcatcatccatggttgtttcttacaaagaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtga |
24181128 |
T |
|
| Q |
144 |
attcatgccaccatcatctctcaatcccaatgaccctagatccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtgaaccacaagag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24181129 |
attcatgccaccatcatctctcaatcccaatgaccctagatccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtgagccacaagag |
24181228 |
T |
|
| Q |
244 |
catatcctcaccacgaccacttccaccaccgctacggcaacagccagcgcgaaaaacagtccaccttttcttaactgtatct |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24181229 |
catatcctcaccacgaccacttccaccaccgctacggcaacagccagcgcgaaaaacagtccaccttttcttaactgtatct |
24181310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 389 - 475
Target Start/End: Original strand, 24181374 - 24181460
Alignment:
| Q |
389 |
gtggtccaattagtcaaagcacaagcccaagtcaaagtacaagcccaagtcatagcccaagtccaatttcaagcccatcatcaccac |
475 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24181374 |
gtggtccaattagtcaaagcacaagcccaagtcaaagtacaagcccaagtcatagcccaagtccaatttcaagcccatcatcaccac |
24181460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 79 - 244
Target Start/End: Complemental strand, 2494823 - 2494658
Alignment:
| Q |
79 |
tacaaagaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtgaattcatgccaccatcatctctcaatcccaa-tgac |
177 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||||| ||||| || ||||| ||||||||||||||| || || || | ||| |||| ||| |
|
|
| T |
2494823 |
tacaaagaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggctgtggtgaattcatgacatcaccaac-agcaacaccaaccgac |
2494725 |
T |
|
| Q |
178 |
cctagatccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtgaaccacaagagc |
244 |
Q |
| |
|
|| | |||| | |||||||||||||||||||| ||||| || |||||||||||||||||| |||||| |
|
|
| T |
2494724 |
ccaacatccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaagagc |
2494658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 70 - 236
Target Start/End: Complemental strand, 3684095 - 3683929
Alignment:
| Q |
70 |
gttgtttcttacaaagaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtgaattcatgccaccatcatctctcaatc |
169 |
Q |
| |
|
|||||| |||||||||||||||||||||| || | ||| |||||||||| ||||| || || || ||| |||||||||||||| || || | || |
|
|
| T |
3684095 |
gttgttacttacaaagaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttgtgaattcatgccatcaccaaccgccacct |
3683996 |
T |
|
| Q |
170 |
ccaatgaccctagatccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtgaacc |
236 |
Q |
| |
|
|| |||||||| ||| | |||||||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3683995 |
ccgatgaccctgcctccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtgaacc |
3683929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 193 - 228
Target Start/End: Complemental strand, 46301127 - 46301092
Alignment:
| Q |
193 |
tgtgctgcttgtggctgtcaccggaatttccaccgc |
228 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46301127 |
tgtgctgcttgtggctgtcaccggaacttccaccgc |
46301092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University