View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_high_20 (Length: 284)
Name: NF14164_high_20
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 99 - 252
Target Start/End: Complemental strand, 35377660 - 35377507
Alignment:
| Q |
99 |
tttaaactaacacgagggactctgctcagcaaacgccagaaacttcaagacagatgttgtgaagaaagnnnnnnntactgctaaaccggttgaataacta |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35377660 |
tttaaagtaacacgagggactctgctcagcaaacgccagaaacttcaagacagatgttgtgaagaaagaaaaaaatactgctaaaccggtagaataacta |
35377561 |
T |
 |
| Q |
199 |
actacccttcnnnnnnnnctaactaccctactttattcctctaacaaaaaacta |
252 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35377560 |
actacccttcaaaaaaaactaactaccctactttattcctctaacaaaaaacta |
35377507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 39 - 107
Target Start/End: Complemental strand, 35378141 - 35378073
Alignment:
| Q |
39 |
ccatcatcacatatgttatcaactatatgccacatttgaccaaacagtgcatacaaatattttaaacta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35378141 |
ccatcatcacatatgttatcaactatatgccacatttgaccaaacagtgcatacaaatattttaaacta |
35378073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University