View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_high_33 (Length: 237)
Name: NF14164_high_33
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 46 - 224
Target Start/End: Complemental strand, 36064763 - 36064586
Alignment:
| Q |
46 |
taattagtataagtgtgtgtacagtgtactaaccttttcttagatgatgaagaagagtgggaagtgactgagccatcgatgttaaatgaggtggaagaag |
145 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064763 |
taattagtataagtgtgtgcactgc-tactaaccttttcttagatgatgaagaagagtgggaagtgactgagccatcgatgttaaatgaggtggaagaag |
36064665 |
T |
 |
| Q |
146 |
gagtggaatcttgagatatgtcagtcaagtcttcctcttggtgagtatgtgggtttttgaattttcttttcatattctt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36064664 |
gagtggaatcttgagatatgtcagtcaagtcttcctcttggtgagtatgtgggtttttgaattttcttttcattttctt |
36064586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University