View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_high_39 (Length: 227)
Name: NF14164_high_39
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 9276902 - 9276696
Alignment:
| Q |
1 |
attttaaaacagaagaaccacacctaagataagaaactttggaactaacacaagtggtatcgatgaaaaaagtttaggtgaatttttactgtgaggttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
9276902 |
attttaaaacagaagaaccacacctaagataagaaactttggaactaacacaagtggtatcgatgaaaaaagtttaggtgaatttttattgtgaggttat |
9276803 |
T |
 |
| Q |
101 |
gggtctaaacacgggtgaagattctcaacctagtaatattaattgagttaaattttataaacaaaatttacatgattttaaattatggtctttttaacga |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
9276802 |
gggtctaaacacgggtcaagattctcaacctagtaatattaattgaattaaattttataaacaaaatttacgtgattttaaattagggtcttgttaacga |
9276703 |
T |
 |
| Q |
201 |
gtgtctt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
9276702 |
gtgtctt |
9276696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University