View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_high_41 (Length: 223)
Name: NF14164_high_41
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 29 - 211
Target Start/End: Complemental strand, 29449195 - 29449014
Alignment:
| Q |
29 |
aaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatattcaagacatgattnnnnnnnngggcgtttttgtgtgaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29449195 |
aaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatattcaagacatgattaaaaaaa-gggcgtttttgtgtgaa |
29449097 |
T |
|
| Q |
129 |
aatgccttgtaggtttcttttgcaagtacatatttgtgaagtgtagtttcttgtattagattttgtgtagtacctttgcttct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29449096 |
aatgccttgtaggtttcttttgcaagtacatatttgtgaagtgtagtttcttgtattagattttgtgtagtacctttgcttct |
29449014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 29 - 90
Target Start/End: Complemental strand, 29457141 - 29457080
Alignment:
| Q |
29 |
aaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatat |
90 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
29457141 |
aaaaggaataatagtccacattatgatattacaacataaaacataccttgtagaaaaaatat |
29457080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 163
Target Start/End: Complemental strand, 29457031 - 29456984
Alignment:
| Q |
116 |
gtttttgtgtgaaaatgccttgtaggtttcttttgcaagtacatattt |
163 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
29457031 |
gtttttgtgtgaaaatactttgtaggtttcttttgcgagtacaaattt |
29456984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University