View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_low_34 (Length: 241)
Name: NF14164_low_34
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 9277240 - 9277027
Alignment:
| Q |
21 |
acagttacggtgccaaatctccttccatcatgttcttatttttctccacaaaacatggaaagttaaagttgcagtcactttcttagcgttcactgttctg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9277240 |
acagttacggtgccaaatctccttccataatgttcttatttttctccacaaaacatggaaagttaaagttgcagtcactttcttagcgttcactgttctg |
9277141 |
T |
 |
| Q |
121 |
gtctactatccaacttatgggctgatatatcattcatccaccgatctatcttggtccttgtcagttacataatattcattgtagttaataatgttcacaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
9277140 |
gtctactatccaacttatgggctgatatatcattcatccaccgatctatcttggtccttgtcagttacatactt---attgtagttaataatgttcacaa |
9277044 |
T |
 |
| Q |
221 |
ctgtatgtgtgaatctt |
237 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9277043 |
ctgtatgtgtgaatctt |
9277027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University