View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_low_39 (Length: 233)
Name: NF14164_low_39
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 28 - 216
Target Start/End: Complemental strand, 36064491 - 36064303
Alignment:
| Q |
28 |
tatctaagcatggaaatgggtttaggtagattgcacaaaatgaaaggcaagtcgacaaataagaaatttaagggagaagaaggtgagagattaggcaaag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064491 |
tatctaagcatggaaatgggtttaggtagattgcacaaaatgaaaggcaagtcgacaaataagaaatttaagggagaagaaggtgagagattaggcaaag |
36064392 |
T |
 |
| Q |
128 |
gcctttnnnnnnnggggattcatgttgacagattggctacgctacatttatggtctttgtttattaggggacatgcgagcaaatacttc |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36064391 |
gcctttaaaaaaaggggattcatgttgacagattggctacgctacatttatggtctttgtttattaggggacgtgcgagcaaatacttc |
36064303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University