View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_low_43 (Length: 227)
Name: NF14164_low_43
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 22868764 - 22868978
Alignment:
| Q |
1 |
tgattttgctctttgggtctttctcaacactcttggcgttttaattgggaaggtaagaaaacagaggttgggccacttt--agtcccatggagtcaaccc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
22868764 |
tgattttgctctttgggtctttctcaacactcttggcgttttaattgggaaggtaagaaaacagaggttgggctactttttagtcccatggagtcaaccc |
22868863 |
T |
 |
| Q |
99 |
nnnnnnnnnnnnnngaagaaaacattgcatattaaattgacattgtcatataaacgtgtgttgggaccaatggtggccaaccaattgcttgtagtactat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22868864 |
cacacacacac----aagaaaacattgcatattaaattgacattgtcatataaacgtgtgttgggaccaatggtggccaaccaattgcttgtagtactat |
22868959 |
T |
 |
| Q |
199 |
tttttggcttcaccctttg |
217 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
22868960 |
tttttggcatcaccctttg |
22868978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University