View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14164_low_45 (Length: 210)
Name: NF14164_low_45
Description: NF14164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14164_low_45 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 82 - 210
Target Start/End: Original strand, 43380053 - 43380181
Alignment:
| Q |
82 |
ttattgtgtttgtattttcttcttctgctcaatagcttgaagtttttctttttgaaatgaaaggttcgggtgagatgttgcatgtcccccatgttctcta |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43380053 |
ttattgtgtttgtattttcttcttctgctcaatagcttgaagtttttctttttgaaatgaaaggttcgggtgagatgttgtatgtcccccatgttctcta |
43380152 |
T |
 |
| Q |
182 |
catgtttaagttcattttttcatccttca |
210 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |
|
|
| T |
43380153 |
catgattaagttcattttttcattcttca |
43380181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 103
Target Start/End: Original strand, 43385906 - 43385949
Alignment:
| Q |
60 |
tgttattgtgtttacttggttattattgtgtttgtattttcttc |
103 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
43385906 |
tgttattgtgtttactttgttattgttgtgtttctattttcttc |
43385949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University