View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14165_high_18 (Length: 202)
Name: NF14165_high_18
Description: NF14165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14165_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 863642 - 863505
Alignment:
| Q |
50 |
aatggaaaacaatgaaaataactcacagggttgtcggtgacgggggaggctgtgtggaacacaccatggcaaccatggacaacagattggatagattgaa |
149 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||| ||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
863642 |
aatggaaaacaaagaaaattccttacagggttgtcagtgacaggagaggctgtgtggaacacaccatggcaaccatgaacaacagattggatagattgaa |
863543 |
T |
 |
| Q |
150 |
gatcaagaagatcaaccttatgcaaagttagcctctct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
863542 |
gatcaagaagatcaaccttatgcaaagttaacctctct |
863505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 138
Target Start/End: Complemental strand, 854049 - 853981
Alignment:
| Q |
70 |
actcacagggttgtcggtgacgggggaggctgtgtggaacacaccatggcaaccatggacaacagattg |
138 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |||||||| ||| |||| || |||||||| |
|
|
| T |
854049 |
actcacagggttgtcggtgacaggataggctgtgtggagtacaccatgacaagcatgaactacagattg |
853981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University