View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14165_high_18 (Length: 202)

Name: NF14165_high_18
Description: NF14165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14165_high_18
NF14165_high_18
[»] chr4 (2 HSPs)
chr4 (50-187)||(863505-863642)
chr4 (70-138)||(853981-854049)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 863642 - 863505
Alignment:
50 aatggaaaacaatgaaaataactcacagggttgtcggtgacgggggaggctgtgtggaacacaccatggcaaccatggacaacagattggatagattgaa 149  Q
    |||||||||||| ||||||  || ||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
863642 aatggaaaacaaagaaaattccttacagggttgtcagtgacaggagaggctgtgtggaacacaccatggcaaccatgaacaacagattggatagattgaa 863543  T
150 gatcaagaagatcaaccttatgcaaagttagcctctct 187  Q
    |||||||||||||||||||||||||||||| |||||||    
863542 gatcaagaagatcaaccttatgcaaagttaacctctct 863505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 138
Target Start/End: Complemental strand, 854049 - 853981
Alignment:
70 actcacagggttgtcggtgacgggggaggctgtgtggaacacaccatggcaaccatggacaacagattg 138  Q
    ||||||||||||||||||||| ||  ||||||||||||  |||||||| ||| |||| || ||||||||    
854049 actcacagggttgtcggtgacaggataggctgtgtggagtacaccatgacaagcatgaactacagattg 853981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University