View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14165_high_8 (Length: 398)
Name: NF14165_high_8
Description: NF14165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14165_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 1956788 - 1956853
Alignment:
| Q |
1 |
ataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaa |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1956788 |
ataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatctaggtaaaaa |
1956853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 1941697 - 1941761
Alignment:
| Q |
1 |
ataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| | || |||||| |||||||||| |||||||| |
|
|
| T |
1941697 |
ataaagggttttgcaattagtgagacagcttttttaatcttccttctcatggcatctaggtaaaa |
1941761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 1927587 - 1927701
Alignment:
| Q |
1 |
ataaagggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaaat-actaaaacttgttttgttttatttatgttta |
99 |
Q |
| |
|
||||||||||||||||| ||||| ||| ||||| ||||| ||| |||||||||| ||||||||||| | | | | || |||| ||||||| |||||| |
|
|
| T |
1927587 |
ataaagggttttgcaataagtgaaacagcttttacaatatttcttctcatggcatctaggtaaaaaataaattacaattattttattttattgatgtttt |
1927686 |
T |
 |
| Q |
100 |
taccttcataatatt |
114 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1927687 |
taccttcataatatt |
1927701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 269 - 312
Target Start/End: Original strand, 36774869 - 36774912
Alignment:
| Q |
269 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774869 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
36774912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University