View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14165_low_19 (Length: 235)
Name: NF14165_low_19
Description: NF14165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14165_low_19 |
 |  |
|
| [»] scaffold1207 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 21 - 212
Target Start/End: Original strand, 11170095 - 11170286
Alignment:
| Q |
21 |
cctaggaattattccgcccatgaggccccctttcatattaattccaaggaccaaaggatggacatccctcaatgtcaaatctttaatcttttcccaaann |
120 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| || |||||| |||| |
|
|
| T |
11170095 |
cctaggaattattacgcccatgaggtcccctttcatattaattccaagggacaaaggattgacatccctcaatgtcaaatcttgaaacttttcacaaatc |
11170194 |
T |
 |
| Q |
121 |
nnnnnacttgctataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataactccgtcccactaccctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11170195 |
gcaccacttgctataaaagcatggacagcagcgccatatgcaaccgcctcatctacattgatgtttttacataactccgtcccactaccctt |
11170286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 11208917 - 11209110
Alignment:
| Q |
21 |
cctaggaattattccgcccatgaggccccctttcatattaattccaaggaccaaaggatggacatccctcaatgtcaaatctttaatcttttcccaaann |
120 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||||||||||||| |||||||| ||| ||||||||||||||||||| || |||||| |||| |
|
|
| T |
11208917 |
cctaggaattattacgctcatgaggccccctttgatattaattccaagggacaaaggattgacttccctcaatgtcaaatcttgaaacttttcacaaatc |
11209016 |
T |
 |
| Q |
121 |
nnnnnacttgctataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataactccgtcccactaccctttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11209017 |
tcaccacttgctataaaagcatggacagcagcgccatatgcaactgcctcatctgcattgatgcttttacataactccgtcccactaccttttt |
11209110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 85 - 202
Target Start/End: Original strand, 11275543 - 11275660
Alignment:
| Q |
85 |
tccctcaatgtcaaatctttaatcttttcccaaannnnnnnacttgctataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgc |
184 |
Q |
| |
|
||||||||||||||||||| || |||||| |||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11275543 |
tccctcaatgtcaaatcttgaaacttttcacaaagctcaccactcaatataaaagcatggatagcagcgccatatgcaaccgcctcatctgcattgatgc |
11275642 |
T |
 |
| Q |
185 |
ttttacataactccgtcc |
202 |
Q |
| |
|
|||| ||||||| ||||| |
|
|
| T |
11275643 |
ttttgcataacttcgtcc |
11275660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 132 - 194
Target Start/End: Original strand, 11155921 - 11155983
Alignment:
| Q |
132 |
tataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataa |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
11155921 |
tatagaagcatggacagcagcgccatatgccaccgcctcatcgacattgatgcttttgcataa |
11155983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 132 - 194
Target Start/End: Original strand, 11196374 - 11196436
Alignment:
| Q |
132 |
tataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataa |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
11196374 |
tatagaagcatggacagcagcgccatatgccaccgcctcatcgacattgatgcttttgcataa |
11196436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 132 - 194
Target Start/End: Original strand, 11199364 - 11199426
Alignment:
| Q |
132 |
tataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataa |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
11199364 |
tatagaagcatggacagcagcgccatatgccaccgcctcatcgacattgatgcttttgcataa |
11199426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 142 - 194
Target Start/End: Complemental strand, 11315240 - 11315188
Alignment:
| Q |
142 |
tggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
11315240 |
tggacagcagcgccatatgcaaccgccttatcagcattgatgcttttgcataa |
11315188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 132 - 194
Target Start/End: Original strand, 11160788 - 11160850
Alignment:
| Q |
132 |
tataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataa |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||| || |||||||| ||||||||||||| ||||| |
|
|
| T |
11160788 |
tatagaagcatggacagcagcgccatatgccactgcctcatcgacattgatgcttttgcataa |
11160850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 11241940 - 11241878
Alignment:
| Q |
132 |
tataaaagcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataa |
194 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| || |||||||| ||||||||||||| ||||| |
|
|
| T |
11241940 |
tatagaagcatggacaacagcgccatatgccacagcctcatcgacattgatgcttttgcataa |
11241878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 198
Target Start/End: Original strand, 11132652 - 11132711
Alignment:
| Q |
139 |
gcatggacagcagcgccatatgcaaccgcctcatctgcattgatgcttttacataactcc |
198 |
Q |
| |
|
|||||||||||||| ||| |||||| || ||||||||||| |||||||| ||||||||| |
|
|
| T |
11132652 |
gcatggacagcagcaccacatgcaatagcttcatctgcatttatgcttttgcataactcc |
11132711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1207 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold1207
Description:
Target: scaffold1207; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 546 - 599
Alignment:
| Q |
154 |
ccatatgcaaccgcctcatctgcattgatgcttttacataactccgtcccacta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
546 |
ccatatgcaaccgcctcatctgcattgatgcttttgcataacttcgtcctacta |
599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University