View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14167_low_7 (Length: 313)
Name: NF14167_low_7
Description: NF14167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14167_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 298
Target Start/End: Complemental strand, 33413772 - 33413486
Alignment:
| Q |
13 |
aaaggaatgagcaaaatcaaaagcgaattttcccatcataatgttttgaagnnnnnnnnn-ccacatgcagcacattttcaagttataaacaccactaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33413772 |
aaaggaatgagcaaaatcaaaagcaaattttcccatcataatgttttgatgttttttttttccacatggagcacattttcaagttataaacaccactaaa |
33413673 |
T |
 |
| Q |
112 |
agttcataaaatcaatctcaagataaggacatggtgctactgtggggctagtgggttgggatgaagcactataatgacaattaacaaatcatatagattt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33413672 |
agttcataaaatcaatctcaagataaggacatggtgctactgtggggctagtgggttgggatgaagcactataatgacaattaacaaatcatatagatta |
33413573 |
T |
 |
| Q |
212 |
tagaagaatcttatagctaacagtggcaaaattgtctagtagtatttgcagcatgctcaaagttttggataagttttaagtgaaaaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33413572 |
tagaagaatcttatagctaacagtggcaaaattgtctagtagtatttgcagcatgctccaagttttggataagttttaagtgaaaaa |
33413486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University