View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14168_low_6 (Length: 274)
Name: NF14168_low_6
Description: NF14168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14168_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 47828848 - 47828662
Alignment:
| Q |
17 |
atgcagagtgtgacagacaagaccttgatgatcccattggcatgataaggatgccatattcttctaagtccttggatagctttgctgctgttgttcctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47828848 |
atgcagagtgtgacagacaagaccttgatgttcccattggcatgataagtatgccatattcttctaagtccttggatagctttgctgctgtggttcctga |
47828749 |
T |
|
| Q |
117 |
attctcttcaatttcaatatatatctgttatcagagattattgattaaacacataagtaatcagagaaataataatgcaattgttgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47828748 |
attctcttcaatttcaatatatatctgttatcagagattattgattaaacacataagtaatcagagaaacaataatgcaattgttgt |
47828662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 212 - 264
Target Start/End: Complemental strand, 47828635 - 47828583
Alignment:
| Q |
212 |
aaatacttacaatattggtttccacagaagatgtatccactctcagtcctttg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47828635 |
aaatacttacaatattggtttccacagaagatgtatccaccctcagtcctttg |
47828583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University