View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14168_low_7 (Length: 246)
Name: NF14168_low_7
Description: NF14168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14168_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 36525851 - 36525635
Alignment:
| Q |
17 |
tagagactgaataggagaaatggtaatagtttagggactaaattgataatttatttgaaaaatgaacttgggaaaggtacgaaggcaatccaccacacta |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525851 |
tagagattgaataggagaaatggtaatagtttagggactaaattgataatttatttgaaaaatgaacttgggaaaggtacgaaggcaatccaccacacta |
36525752 |
T |
|
| Q |
117 |
ctgcaaatcgacaaattatagtacttaaaaacaattaaggaacgtcaagccacagtacaggattaaaagttagtnnnnnnnnncacgagactaggatatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
36525751 |
ctgcaaatcgacaaattatagtacttaaaaacaattaaggaacgtcaagccacagtacaggattaaaagttggt-aaaaaaaacacgagactaggatatg |
36525653 |
T |
|
| Q |
217 |
ttctattttacacaggtt |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36525652 |
ttctattttacacaggtt |
36525635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University