View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14169_high_7 (Length: 205)
Name: NF14169_high_7
Description: NF14169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14169_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 12 - 170
Target Start/End: Complemental strand, 28786568 - 28786410
Alignment:
| Q |
12 |
atgaacaaacaagacagacctattttcacatcgaagagtttataggtttgaagannnnnnnnattgcaatcgcaatagttcccatnnnnnnnnttatttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
28786568 |
atgaacaaacaagacagacctattttcacatcgaagagtttataggtttgaagattttttttattgcaatcgtaatagttcccatgaaaaaatttatttt |
28786469 |
T |
|
| Q |
112 |
ctgaattttttgatcaaattcgtgtatgtataagtagaagctaacttagaattccacat |
170 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
28786468 |
ctgaattttttgatcaaattcgtctttgtataagtagaagctaacttagaattccacat |
28786410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 164 - 195
Target Start/End: Original strand, 23384419 - 23384450
Alignment:
| Q |
164 |
tccacatttagatttgtctttgcactctgcaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23384419 |
tccacatttagatttgtctttgcactctgcaa |
23384450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 41235863 - 41235904
Alignment:
| Q |
164 |
tccacatttagatttgtctttgcactctgcaacaaaaaatct |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41235863 |
tccacatttagatttgtttttgcactctgcaacaaaaaatct |
41235904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University