View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14169_low_6 (Length: 266)
Name: NF14169_low_6
Description: NF14169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14169_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 5 - 246
Target Start/End: Complemental strand, 26427715 - 26427472
Alignment:
| Q |
5 |
aaaaatatagtgcatgcttcaatttcctgactggtgtttgtataccatataatttttt--gaatgcctttgcagaaccggtcattattaactgctgctga |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427715 |
aaaaatatagtgcatgcttcaatttcctgactggtgtttgtataccatataattttttttgcatgcctttgcagaaccggtcattattaactgctgctga |
26427616 |
T |
|
| Q |
103 |
aagtaaacttgcagaagcaagaaatcaatacgatcaaatggtagagaataagcagttggaattgtcaaagcatttaaaagaaatatctcaaagaaatgat |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427615 |
aagtaaacttgcagaagctagaaatcaatacgatcaaatggtagagaataagcagttggaattgtcaaagcatttaaaagaaatatctcaaagaaatgat |
26427516 |
T |
|
| Q |
203 |
caggtgttgcatataactggttacctataataggtgcttgatgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427515 |
caggtgttgcatataactggttacctataataggtgcttgatgt |
26427472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University