View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14169_low_7 (Length: 262)
Name: NF14169_low_7
Description: NF14169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14169_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 40508989 - 40509213
Alignment:
| Q |
16 |
tcaaggtgctttttagattatatttagtggtttggcagggttagttttgatttttgattaaattaaattgggatactcatttgcttgttatcatgtaatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
40508989 |
tcaaggtgctttttagattatatttagtggtttggcagggttagttttggtttttgattaaattaaattgagacactcatttgcttgttatcatgtaatg |
40509088 |
T |
|
| Q |
116 |
ggataattttgattttgttgtgtttggaaactggattacttcaaaatatatacaatcaaattcagtatctcgaggtttacaataatcacaaacgaaacga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40509089 |
ggataattttgattttgttgtgtttggaaactggattacttc--aatatatacaatcaaattcagtatctcgaggtttacaataatcacaaacgaaacga |
40509186 |
T |
|
| Q |
216 |
atcaaccatttgcgctagaatcctagg |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40509187 |
atcaaccatttgcgctagaatcctagg |
40509213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University