View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1416_low_5 (Length: 273)
Name: NF1416_low_5
Description: NF1416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1416_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 267
Target Start/End: Complemental strand, 1327258 - 1327000
Alignment:
| Q |
9 |
gaacaaaatcattttcaaaagaaggtccaaatgttggatttataggattaaagtaggaatcaatgacactctttgttacaaagtcatcattaagtcttgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1327258 |
gaacaaaatcattttcaaaagaaggtccaaatgttggatttataggattgaagtaggaatcaatgacactctttgttacaaagtcatcattaagtcttgc |
1327159 |
T |
 |
| Q |
109 |
atcagaagctaacacagcaaaaccttcccttatgtttttcaatatactcttgtcaaatttcagatcactcccttcatccatggctaaacggatgttgata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1327158 |
atcagaagctaacacagcaaaaccttcccttatgtttttcaatatactcttgtcaaatttcagatcactcccttcatccatggctaaacggatgttgaca |
1327059 |
T |
 |
| Q |
209 |
tctccatccttagggcaccttgctttcagttctgggagaaaattcagattaatagttgg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1327058 |
tctccatccttagggcaccttgctttcagttctgggagaaaattcaggttaatagttgg |
1327000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University