View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1416_low_6 (Length: 250)
Name: NF1416_low_6
Description: NF1416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1416_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 48925839 - 48925616
Alignment:
| Q |
9 |
gagatgaaggatgatggttttcagcctgatgtggttacttatggtataatcatcactgcttattgtaaggcgaaaaagtatgacgaggctattggtattt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48925839 |
gagatgaaggatgatggttttcagcctgatgtggttacttatggtataatcatcaatgcttattgtaaggcgaaaaagtatgacgaggctattggtattt |
48925740 |
T |
 |
| Q |
109 |
atcatgacatgctatcaaagaatgtaaatcctagtcctcatatatattgtacttttattaatggtcttggtaatggtagtcgaatgactgaagattttga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
48925739 |
atcatgacatgctatcaaagaatgtaaatcctagtcctcatatatattgtacttttattactggtcttggtaatggtagtagaatggatgaagcttttga |
48925640 |
T |
 |
| Q |
209 |
attctttgcaaaatctaaggctag |
232 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
48925639 |
attctttgaaaaatctaaggctag |
48925616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University