View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1416_low_7 (Length: 240)
Name: NF1416_low_7
Description: NF1416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1416_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 15115798 - 15115587
Alignment:
| Q |
12 |
cataggtgtaatcatattcgtaatcgttgcagggttttctcatgcaaatacatcaaacttgacaccttttttaccttatggagttaaaggtgtatttcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15115798 |
cataggtgtaatcatattcgtaatcgttgcaggattttctcatgcaaatacatcaaacttgacaccttttttaccttatggagttaaaggtgtatttcaa |
15115699 |
T |
 |
| Q |
112 |
gcatctgcaattctatattttgcatatggagggtttgacagtcttgcaaccatggctgaagaaactaaaaatccgccaaaggacataccaataggcttga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15115698 |
gcatctgcaattctatattttgcatatggagggtttgacagtcttgcaaccatggctgaagaaactaaaaatccgccaaaggacataccaataggcttga |
15115599 |
T |
 |
| Q |
212 |
ttggttcaatgt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15115598 |
ttggttcaatgt |
15115587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University