View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14171_high_6 (Length: 252)
Name: NF14171_high_6
Description: NF14171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14171_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 5075246 - 5075485
Alignment:
| Q |
1 |
taagttgataagttactaaacaccatatatggtggcaacgacatttgacttggaggcggtgacctctttcatgacaacggtggtagtcttttatcgatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5075246 |
taagttgataagttactaaacaccatatatggtggcaacgacatttgacttggaggcggtgacctctttcatgacaacggtggtagtcttttatcgatta |
5075345 |
T |
 |
| Q |
101 |
gaaaccgtatgatcagatcatttcatcaacctaagcctcttcttggtgtacgcaaagtttaaattatcccttaataatgaat---atccttaggattttt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5075346 |
gaaaccgtatgatcagatcatttcatcaacctaagcctcttcttggtgtatgcaaagtttaaattatcccttaataatgaatataatccttaggattttt |
5075445 |
T |
 |
| Q |
198 |
ggataatttgatcacttgctcaaatagtttatgactaatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5075446 |
ggataatttgatcacttgctcaaatagtttatgactaatt |
5075485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University