View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14171_low_11 (Length: 304)
Name: NF14171_low_11
Description: NF14171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14171_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 81 - 285
Target Start/End: Original strand, 2464924 - 2465122
Alignment:
| Q |
81 |
gttatgctgaagtggtatgaaactagggaagtccactacataccacgcccagactaagaataaacaaagattgtgaaaaagggcatttaacgatgtttga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
2464924 |
gttatgctgaagtggtatgaaactagggaagtccaccacataccacgcccagactaagaataaacaaagactgtgaaaa-gggcatttaacgatgtttga |
2465022 |
T |
 |
| Q |
181 |
gatgttgtgtttataacagaagaaatcaatggagaaaatttttacactctagagtggcactaaaacactaccactcaaataaaggctgtcgccaggtctg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2465023 |
gatgttgtgtttataacagaagaaatcaatggagaaattttttacactccagagtgccactaaa-----accactcaaataaaggctgtcgccaggtctg |
2465117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 11 - 73
Target Start/End: Original strand, 2463221 - 2463283
Alignment:
| Q |
11 |
taattctcaaattcattggttcaaaaaatttataatgttggcctcaaatcttgaaccatacca |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2463221 |
taattctcaaattcattggttcaaaaaatttataatgttggcctcaaatcttgaaccatacca |
2463283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University