View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14171_low_15 (Length: 225)
Name: NF14171_low_15
Description: NF14171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14171_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 71 - 182
Target Start/End: Complemental strand, 698676 - 698565
Alignment:
| Q |
71 |
agaatttattgttgaattaaattaactaataaggatgaaaccttcaaaacaaaaggacgacctttgagtgnnnnnnnttataatctataaactcaaatat |
170 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
698676 |
agaatttattgtttaattaaattaactaataaggatgaaaccttcaaaacaaaaggatgacctttgagtgaaaaaaattataatctataaactcaaatat |
698577 |
T |
|
| Q |
171 |
atgttacttgtt |
182 |
Q |
| |
|
|||||||||||| |
|
|
| T |
698576 |
atgttacttgtt |
698565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 699755 - 699718
Alignment:
| Q |
17 |
atgaacctaaagagaataacatataaattagctgataa |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
699755 |
atgaacctaaagagaataacatataaattagttgataa |
699718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University