View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14172_low_9 (Length: 340)
Name: NF14172_low_9
Description: NF14172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14172_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 20 - 157
Target Start/End: Original strand, 26204111 - 26204248
Alignment:
| Q |
20 |
tattgtacagcatgtattttcaaaattattgcttggttatatgtccagtcaatttgattcaattattttttggtactgtcgttgttagtaactgtaacat |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26204111 |
tattgtaccgcatgtattttcaaaattattgcttggttatatgtccagtcaatttgattcaattattttttggtaccgtcgttgttagtaactgtaacat |
26204210 |
T |
|
| Q |
120 |
tatttggatcatagtattaacgaatgacttgggatacc |
157 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26204211 |
tatttggatcatactattaacgaatgacttgggatacc |
26204248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 200 - 340
Target Start/End: Original strand, 26204289 - 26204429
Alignment:
| Q |
200 |
aactgttacaaatttgaatgtatacgttttaaaaactattttnnnnnnncagtaacaaacgtgtcgaactttttaagactaaagatctgatttaatctct |
299 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26204289 |
aactgttacaaatttcaatgtaaacgttttaaaaactattttagaaaaacagtaacaaacgtgtcgaactttttaagactaaagatctgatttaatctct |
26204388 |
T |
|
| Q |
300 |
cacaatttaagtgcggatcaatttaattaccgacacaaatt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26204389 |
cacaatttaagtgcggatcaatttaattaccgagacaaatt |
26204429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 334
Target Start/End: Original strand, 26198218 - 26198283
Alignment:
| Q |
269 |
tttttaagactaaagatctgatttaatctctcacaatttaagtgcggatcaatttaattaccgaca |
334 |
Q |
| |
|
||||||||||| | |||| ||||||||||||| ||||| ||||| | |||||||||||||||||| |
|
|
| T |
26198218 |
tttttaagacttatgatccaatttaatctctcataatttgagtgctggtcaatttaattaccgaca |
26198283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University